View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11647_low_15 (Length: 241)

Name: NF11647_low_15
Description: NF11647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11647_low_15
NF11647_low_15
[»] chr5 (1 HSPs)
chr5 (1-220)||(5493678-5493897)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 5493678 - 5493897
Alignment:
1 cattggctgtaactctggactcggccgataccgatcggatcgcttaacggaattcagtttatgatacggtgaacggttaggcttctccgtttgattctga 100  Q
    ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5493678 cattggctgtaactccggactcggacgataccgatcggatcgcttaacggaattcagtttatgatacggtgaacggttaggcttctccgtttgattctga 5493777  T
101 tcgttgaccgtcgttgaccttctcgaaggttccacagttccaatgtagagaaaattcgaagctactaccggagcagatgaattcgatgaatcttgaagag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5493778 tcgttgaccgtcgttgaccttctcgaaggttccacagttccaatgtagagaaaattcgaagctactaccggagcagatgaattcgatgaatcttgaagag 5493877  T
201 aattgttcctctgtgtggta 220  Q
    ||||||||||||||||||||    
5493878 aattgttcctctgtgtggta 5493897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University