View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11648_high_23 (Length: 254)
Name: NF11648_high_23
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11648_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 5033719 - 5033505
Alignment:
| Q |
1 |
atcaaacaccttaattgcaactcataaaaatcaatgtgtcattgccatgaaaaagg----tgcatat-aaaaggtgaaatttagtttatgtagttaaaat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5033719 |
atcaaacaccttaattgcaactcataaaaatcaatgtgtcattgccatgaaaaatagaattgcatattaaaaggtgaaatttagtttatgtagttaaaat |
5033620 |
T |
|
| Q |
96 |
ctgttgtagaaaactagtctatgagagactcgtatggctaagtgtcagataatttcaaccttaacctagtgattagctaaaacaattctcagctcataca |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5033619 |
ctgttgtagaaaacttgtctatgagagactcgtatggccaagtgtcagataatttcaaccttaacctagtgattagctaaaacaattcttagctcataca |
5033520 |
T |
|
| Q |
196 |
agaagaaatagtctt |
210 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5033519 |
agaagaaatagtctt |
5033505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 198 - 245
Target Start/End: Complemental strand, 5033487 - 5033440
Alignment:
| Q |
198 |
aagaaatagtctttatactcatgctgcgagacattactaaactttctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033487 |
aagaaatagtctttatactcatgctgcgagacattactaaactttctc |
5033440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 63 - 108
Target Start/End: Original strand, 5026368 - 5026413
Alignment:
| Q |
63 |
taaaaggtgaaatttagtttatgtagttaaaatctgttgtagaaaa |
108 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
5026368 |
taaaaggtgaaatttattttatgtaattaacatctgttgtagaaaa |
5026413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University