View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11648_high_31 (Length: 240)
Name: NF11648_high_31
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11648_high_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 4556757 - 4556686
Alignment:
| Q |
9 |
cagtattgactttcaaatagttaatgaaatattgcaataacttttacata-ttacatgaccaattaggttgg |
79 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4556757 |
cagtattgactttcacatagttaatgaaatattgcaataacttttacatatttacatgaccaattaggttgg |
4556686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 224
Target Start/End: Complemental strand, 4556585 - 4556548
Alignment:
| Q |
187 |
acagtaagtttaataaaatttacactgtaggaaagtct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4556585 |
acagtaagtttaataaaatttacactgtaggaaagtct |
4556548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University