View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11648_high_38 (Length: 215)
Name: NF11648_high_38
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11648_high_38 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 48567290 - 48567118
Alignment:
| Q |
17 |
aatatctgataccggtctctctgttcgttttgagcagtgatcaagttttttaataaattttgccgaagttgttgataaccgccagtatacgacaaacaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48567290 |
aatatctgataccggtctctctgttcgttttgagcagtgatcaagttttttaataaattttgccgaagttgttgataaccgccagtatacgacaaacaaa |
48567191 |
T |
|
| Q |
117 |
aaatgtcgttcaaaagtcgtataagttcaatgtttagggataattgaatgtattgctaactatggcggagaaa |
189 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
48567190 |
aaatgtcgttcaaaagtcttataagttcaatgtttagggataattgaatgtattgctaactacggcggggaaa |
48567118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 78
Target Start/End: Original strand, 37112 - 37156
Alignment:
| Q |
34 |
tctctgttcgttttgagcagtgatcaagttttttaataaattttg |
78 |
Q |
| |
|
||||||||||| |||||||| ||||| ||| |||||||||||||| |
|
|
| T |
37112 |
tctctgttcgtcttgagcagggatcaggttgtttaataaattttg |
37156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University