View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11648_low_25 (Length: 254)

Name: NF11648_low_25
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11648_low_25
NF11648_low_25
[»] chr8 (3 HSPs)
chr8 (1-210)||(5033505-5033719)
chr8 (198-245)||(5033440-5033487)
chr8 (63-108)||(5026368-5026413)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 5033719 - 5033505
Alignment:
1 atcaaacaccttaattgcaactcataaaaatcaatgtgtcattgccatgaaaaagg----tgcatat-aaaaggtgaaatttagtttatgtagttaaaat 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||| ||||||||||||||||||||||||||||||||    
5033719 atcaaacaccttaattgcaactcataaaaatcaatgtgtcattgccatgaaaaatagaattgcatattaaaaggtgaaatttagtttatgtagttaaaat 5033620  T
96 ctgttgtagaaaactagtctatgagagactcgtatggctaagtgtcagataatttcaaccttaacctagtgattagctaaaacaattctcagctcataca 195  Q
    ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
5033619 ctgttgtagaaaacttgtctatgagagactcgtatggccaagtgtcagataatttcaaccttaacctagtgattagctaaaacaattcttagctcataca 5033520  T
196 agaagaaatagtctt 210  Q
    |||||||||||||||    
5033519 agaagaaatagtctt 5033505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 198 - 245
Target Start/End: Complemental strand, 5033487 - 5033440
Alignment:
198 aagaaatagtctttatactcatgctgcgagacattactaaactttctc 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
5033487 aagaaatagtctttatactcatgctgcgagacattactaaactttctc 5033440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 63 - 108
Target Start/End: Original strand, 5026368 - 5026413
Alignment:
63 taaaaggtgaaatttagtttatgtagttaaaatctgttgtagaaaa 108  Q
    |||||||||||||||| |||||||| |||| |||||||||||||||    
5026368 taaaaggtgaaatttattttatgtaattaacatctgttgtagaaaa 5026413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University