View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11648_low_30 (Length: 246)
Name: NF11648_low_30
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11648_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 5033727 - 5033948
Alignment:
| Q |
1 |
ttgaggagagtgatttcatcctcaactttgcaacgaatgcaattaaggtatgtgatgaagtgaaaccatactcaagtcaataatcaattagttttcactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033727 |
ttgaggagagtgatttcatcctcaactttgcaacgaatgcaattaaggtatgtgatgaagtgaaaccatactcaagtcaataatcaattagttttcactt |
5033826 |
T |
 |
| Q |
101 |
aaggaatgttgttgctgtttaccacatcttatatggttttatagttatgttgcctttttattatt-gcttatttcaacattaagatggctgtgacttgga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5033827 |
aaggaatgttgttgctgtttaccacatcttatatggttttatagttatgttgcctttttattatttgcttatttcaacattaagatggctgtgact---- |
5033922 |
T |
 |
| Q |
200 |
gacttggagttgtagcttgtaagtaaaggg |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5033923 |
----tggagttgtagcttgtaagtaaaggg |
5033948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University