View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11648_low_32 (Length: 241)
Name: NF11648_low_32
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11648_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 39730256 - 39730060
Alignment:
| Q |
12 |
agcagagataactatttaaacacgtattgagcaagcacatgaaaaaagaatatattcgtcatacttttttcaaagataatgtatgaataacatagcatca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39730256 |
agcagagataactatttaaacacgtattgagcaagcacatgaaaaaagaatctattcgtcatacttttttcaaagataatgtatgaataacatagcatca |
39730157 |
T |
 |
| Q |
112 |
atttttgcgacattttgcatatacattcatcgatcttcgatgaatcatgcatttgacattagtagatatttgagcactgcactaacgtaatcatcggtaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39730156 |
atttttgcgacattttgcatatacattc--------------aatcatgcattagacattagtagatatttgagcactgcaccaacgtaatcatcggtaa |
39730071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University