View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11648_low_39 (Length: 225)
Name: NF11648_low_39
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11648_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 210
Target Start/End: Original strand, 34839847 - 34840001
Alignment:
| Q |
56 |
aaatcccatctattggcattttcaaactgggaacagtgaaagtccttgcaaactgttttctatgcttttctacaccaatatcgtttgaatttggattatc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34839847 |
aaatcccatctattggcattttcaaactgggaacagtgaaagtccttgcaaactgttttctatgcttttctacaccaacatcgtttgaatttggattatc |
34839946 |
T |
|
| Q |
156 |
tatgcttttatattgttgcagcgacttgatatcattttatctaattgttcctatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34839947 |
tatgcttttatattgttgcagcgacttgatatcattttatctaatcgttcctatg |
34840001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 35865840 - 35865759
Alignment:
| Q |
106 |
aactgttttctatgctttt-ctacaccaatatcgtttgaatttggattatctatgcttttatattgttgcagcgacttgata |
186 |
Q |
| |
|
||||||||||||||||||| ||| || || ||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
35865840 |
aactgttttctatgctttttctatactaacatcgtttgaatttggatgatctatgcttttctattgttgcagcgacttgata |
35865759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 34839768 - 34839813
Alignment:
| Q |
6 |
aacgttgataactctttttcttcagtacgaatgtgctatgataaca |
51 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
34839768 |
aacgttgataactctatttcttcagtacgaatgttctatgataaca |
34839813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 186
Target Start/End: Complemental strand, 34815620 - 34815544
Alignment:
| Q |
110 |
gttttctatgcttttctacaccaatatcgtttgaatttggattatctatgcttttatattgttgcagcgacttgata |
186 |
Q |
| |
|
||||||| |||||||||| || || | |||| ||||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
34815620 |
gttttctgtgcttttctatactaacactgtttaaatttggattatctatgttttcctattgttgcagagacttgata |
34815544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University