View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11648_low_39 (Length: 225)

Name: NF11648_low_39
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11648_low_39
NF11648_low_39
[»] chr5 (4 HSPs)
chr5 (56-210)||(34839847-34840001)
chr5 (106-186)||(35865759-35865840)
chr5 (6-51)||(34839768-34839813)
chr5 (110-186)||(34815544-34815620)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 210
Target Start/End: Original strand, 34839847 - 34840001
Alignment:
56 aaatcccatctattggcattttcaaactgggaacagtgaaagtccttgcaaactgttttctatgcttttctacaccaatatcgtttgaatttggattatc 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
34839847 aaatcccatctattggcattttcaaactgggaacagtgaaagtccttgcaaactgttttctatgcttttctacaccaacatcgtttgaatttggattatc 34839946  T
156 tatgcttttatattgttgcagcgacttgatatcattttatctaattgttcctatg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
34839947 tatgcttttatattgttgcagcgacttgatatcattttatctaatcgttcctatg 34840001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 35865840 - 35865759
Alignment:
106 aactgttttctatgctttt-ctacaccaatatcgtttgaatttggattatctatgcttttatattgttgcagcgacttgata 186  Q
    ||||||||||||||||||| ||| || || ||||||||||||||||| |||||||||||| |||||||||||||||||||||    
35865840 aactgttttctatgctttttctatactaacatcgtttgaatttggatgatctatgcttttctattgttgcagcgacttgata 35865759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 34839768 - 34839813
Alignment:
6 aacgttgataactctttttcttcagtacgaatgtgctatgataaca 51  Q
    ||||||||||||||| |||||||||||||||||| |||||||||||    
34839768 aacgttgataactctatttcttcagtacgaatgttctatgataaca 34839813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 186
Target Start/End: Complemental strand, 34815620 - 34815544
Alignment:
110 gttttctatgcttttctacaccaatatcgtttgaatttggattatctatgcttttatattgttgcagcgacttgata 186  Q
    ||||||| |||||||||| || || |  |||| ||||||||||||||||| |||  ||||||||||| |||||||||    
34815620 gttttctgtgcttttctatactaacactgtttaaatttggattatctatgttttcctattgttgcagagacttgata 34815544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University