View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11648_low_41 (Length: 215)

Name: NF11648_low_41
Description: NF11648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11648_low_41
NF11648_low_41
[»] chr4 (1 HSPs)
chr4 (17-189)||(48567118-48567290)
[»] scaffold0050 (1 HSPs)
scaffold0050 (34-78)||(37112-37156)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 48567290 - 48567118
Alignment:
17 aatatctgataccggtctctctgttcgttttgagcagtgatcaagttttttaataaattttgccgaagttgttgataaccgccagtatacgacaaacaaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48567290 aatatctgataccggtctctctgttcgttttgagcagtgatcaagttttttaataaattttgccgaagttgttgataaccgccagtatacgacaaacaaa 48567191  T
117 aaatgtcgttcaaaagtcgtataagttcaatgtttagggataattgaatgtattgctaactatggcggagaaa 189  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
48567190 aaatgtcgttcaaaagtcttataagttcaatgtttagggataattgaatgtattgctaactacggcggggaaa 48567118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 78
Target Start/End: Original strand, 37112 - 37156
Alignment:
34 tctctgttcgttttgagcagtgatcaagttttttaataaattttg 78  Q
    ||||||||||| |||||||| ||||| ||| ||||||||||||||    
37112 tctctgttcgtcttgagcagggatcaggttgtttaataaattttg 37156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University