View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11649_high_11 (Length: 260)
Name: NF11649_high_11
Description: NF11649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11649_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 10049930 - 10050175
Alignment:
| Q |
11 |
attctatataaatgtaatttcttcttttttattgcttagctatgatgcgaattcgcgatatagatacctaaaatttatccaaccattgactgattcattc |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10049930 |
attctatataaatgtaatttcttgttttttattgcttagctatgatgcaaattcgcgatttagatacctagaatttatccaaccattgactgattcattc |
10050029 |
T |
 |
| Q |
111 |
ttatacaatgtatatttcacatattgtgttacatgcattatgtgcagctttagcactagtagacttgtaaagtttttgatgttgcaactattttataata |
210 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10050030 |
ttatacaatatatatttcacataatgtgttacatgcattatgtgcagctttagcactagtagacttgtaaagtttttgatgttgtaactattttataata |
10050129 |
T |
 |
| Q |
211 |
tgttctatcagattggatgcgcattggtgctttttcctttgcttct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10050130 |
tgttctatcagattggatgcgcattggtgctttttcctttgattct |
10050175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University