View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11649_high_5 (Length: 328)
Name: NF11649_high_5
Description: NF11649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11649_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 36884502 - 36884192
Alignment:
| Q |
1 |
ctggctactaacttctttaatgaaggcaaccttctgggagagggatctcttggtcccgtttacaaagctgtatttcctgagggcaaagtataatcttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36884502 |
ctggctactaacttctttaatgaaggcaaccttctgggagagggatctcttggtcccgtttacaaagctgtatttcctgagggcaaagtataatcttaat |
36884403 |
T |
 |
| Q |
101 |
ctatttttcaaaactgaaattttctttgtatcatgttttggtttcaaattaatgtaacgttttttccgttttgttgaagaatttggcggtgaagatcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36884402 |
ctatttttcaaaactgaaattttctttgtatcgtgttttggtttcaaattaatgtaacatttttttcgttttgttgaagaatttggcggtgaagatcata |
36884303 |
T |
 |
| Q |
201 |
aacatggcgggtctgtcttacagagaagaggaaaagttcatggatgtcatttgcacggcttccaaactgaagcaccccaatatcgtagcactcaatggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36884302 |
aacatggcgggtctgtcttacagagaagaggaaaagttcatggatgtcatttgcacggcttccaaactgaagcaccccaatatcgtagcactcaatggtt |
36884203 |
T |
 |
| Q |
301 |
actgttttgag |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
36884202 |
actgttttgag |
36884192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University