View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11649_high_9 (Length: 284)
Name: NF11649_high_9
Description: NF11649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11649_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 5 - 245
Target Start/End: Complemental strand, 10049931 - 10049691
Alignment:
| Q |
5 |
atatagaattgtgcataagcaataaggtttaccatgtacatatataattgtcagatctagatttagggcattcaataactctagtcaatctaaggcattt |
104 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
10049931 |
atatagaattttgcataagcaataaggtttaccatgtacatatataattgtcagatctatatttagggcattcaataactcttgtcaatccaaggcattt |
10049832 |
T |
|
| Q |
105 |
gataaaagattgatgactcacacaaatcaaaaactcaaaagcattaactgtgcggtcacttaccacatcaaattcatttccataactgtgtgtggaatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10049831 |
gataaaagattgatgactcacacaaatcaaaaactcaaaagcattaactgtgtggtcacttaccacatcaaattcatttccataactgtgtgtggaatct |
10049732 |
T |
|
| Q |
205 |
attaaaatttattgtgaatctcgcaatatattaggatatag |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10049731 |
attaaaatttattgtgaatctcacaatatattaggatatag |
10049691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University