View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11649_low_6 (Length: 321)
Name: NF11649_low_6
Description: NF11649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11649_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 16 - 311
Target Start/End: Complemental strand, 32762583 - 32762288
Alignment:
| Q |
16 |
ttgtgaacaaaccagattgttctggactaaggagtttcgaaagtccaaaatcagatatcttagcttgaaattgatcatgcagaagaatattctctggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32762583 |
ttgtgaacaaaccagattgttctggactaaggagtttcgaaagtccaaaatcagatatcttagcttgaaattgatcatgcagaagaatattctctggttt |
32762484 |
T |
 |
| Q |
116 |
gatatcacagtgaattatcttttgctcacatccactgtgaagataagcgagtccgcgcgctgttccaagggccacatcacacctctcttgccattccaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32762483 |
gatatcacagtgaattatcttttgctcacatccactgtgaagataagcgagtccgcgcgctgttccaagggccacatcacacctctcttgccattccaaa |
32762384 |
T |
 |
| Q |
216 |
accggatgtccaccgaagaggttccggtcgagtgagccgcggttcatgtactcgtacaccaacattcggtgtcccctttgagcacaaaagcctttg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32762383 |
accggatgtccaccgaagaggttccggtcgagtgagccgcggttcatgtactcgtacaccaacattcggtgtcccctttgagcacaaaagcctttg |
32762288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University