View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1164_low_19 (Length: 322)
Name: NF1164_low_19
Description: NF1164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1164_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 80 - 322
Target Start/End: Complemental strand, 30634872 - 30634630
Alignment:
| Q |
80 |
agatgaagaggccacagattggcattcatagttatgatgccaagaagatgtctgcatgaagcgagagtctaaaggaaatgtgggcaatataattgcatgt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634872 |
agatgaagaggccacagattggcattcatagttatgatgccaagaagatgtctgcatgaagcgagagtctaaaggaaatgtgggcaatataattgcatgt |
30634773 |
T |
 |
| Q |
180 |
ttggcccctgatttgaaatcaagatcgacatacgaaacatgacctctatcaatggctaaaattcgaatggctctactctttctccaatcacctatctccc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634772 |
ttggcccctgatttgaaatcaagatcgacatacgaaacatgacctctatcaatggctaaaattcgaatggctctactctttctccaatcacctatctccc |
30634673 |
T |
 |
| Q |
280 |
actcccaaaactcttgtggaggggctccgattgaacaatttac |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634672 |
actcccaaaactcttgtggaggggctccgattgaacaatttac |
30634630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University