View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1164_low_20 (Length: 320)

Name: NF1164_low_20
Description: NF1164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1164_low_20
NF1164_low_20
[»] chr3 (1 HSPs)
chr3 (11-291)||(43341398-43341678)


Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 291
Target Start/End: Complemental strand, 43341678 - 43341398
Alignment:
11 gatgaaggtttgttcacttgtattgtattggtgtattagtcgcaatttggtgccttgtgttctttattagtatctatcattgtgaatgtgaaatttgcaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43341678 gatgaaggtttgttcacttgtattgtattggtgtattagtcgcaatttggtgccttgtgttctttattagtatctatcattgtgaatgtgaaatttgcaa 43341579  T
111 actttgtagttcttcgattcaagtcttatatgccttgtgcttgaatcaagaaaattaatatattttgctgtttcaaaagaaaaaatgatgaacaattttt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
43341578 actttgtagttcttcgattcaagtcttatatgccttgtgcttgaatcaagaaaattaatatattttgctgtttcaaaagaaaaaatgatgagcaattttt 43341479  T
211 taacctagaaatgatttcaatgcaggagccaaagttgccagattattcaaaccggaaaatgaatccaaaaacaagacaaac 291  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43341478 taacctagaaatgatttcaatgcaggagccaaagttgccagattattcaaaccggaaaatgaatccaaaaacaagacaaac 43341398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University