View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1164_low_22 (Length: 296)
Name: NF1164_low_22
Description: NF1164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1164_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 20 - 283
Target Start/End: Complemental strand, 42348436 - 42348173
Alignment:
| Q |
20 |
atgaacatactcaagcttgccaatgggaaagactctgcggctacccttttgatcagaagaaacaccaatgaatgcaccattgatcaaagaaccaccagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42348436 |
atgaacatactcaagcttgccaatgggaaagactctgcggctacccttttgatcagaagaaacaccaatgaatgcaccattgatcaaagaaccaccagaa |
42348337 |
T |
 |
| Q |
120 |
gcaggagtaacaagaacattctcatgaacctgactcagaaccttcttccctaacaccatcaagtttccatcaccaacagatattcctgcccctacagtca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42348336 |
gcaggagtaacaagaacattctcatgaacctgactcagaaccttcttccctaacaccatcaagtttccatcaccaacagatattcctgcccctacagtca |
42348237 |
T |
 |
| Q |
220 |
tctttttgttgaaaattcacttcaaaagatttcaacaaagggaatgaacccttagcaatgctct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42348236 |
tctttttgttgaaaattcacttcaaaagatttcaacaaagggaatgaacccttagcaatgctct |
42348173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University