View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1164_low_24 (Length: 280)
Name: NF1164_low_24
Description: NF1164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1164_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 40 - 214
Target Start/End: Complemental strand, 13060952 - 13060782
Alignment:
| Q |
40 |
ataatactcatacaatttacgcacaaaccacttgtgttggaatgtaatggttaagttttcgattatctttttgtgtataataaatcgtataggttaatta |
139 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| || |
|
|
| T |
13060952 |
ataacactcatagaatttacgcacaaaccacttgtgttggaatgtaatggttaagttttcgattatcattttgtgtataataaatagtataggt----ta |
13060857 |
T |
 |
| Q |
140 |
atgttacgcactagactcagatgatatctttgtgtatatatgtgttcctaagagactccttcagcccctatatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
13060856 |
atgttacgcactagactcagatgatatctctgtgtatatatgtgttccaatgagactccttcagcccctatatat |
13060782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University