View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1164_low_27 (Length: 261)
Name: NF1164_low_27
Description: NF1164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1164_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 10470126 - 10469908
Alignment:
| Q |
15 |
agcatctttagttttccatactatctagatgctagagaaccatatggtctggtctcccaaatgggaagaccgccatttcaaagattcactccacaccacc |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470126 |
agcatctctagttttccatactatctagatgctagagaaccatatggtcgggtctcccaaatgggaagaccgccatttcaaagattcactccacaccact |
10470027 |
T |
 |
| Q |
115 |
tataaaattgaccaattaaagaagatgatttaggatttctagatttcaacaataagatgaagaattgatattga-nnnnnnnnncttcctaaagttatca |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10470026 |
tataaaattgaacaattaaagaagatgatttaggatttctagatttccacaataagatgaagaattgatattgattttttttttcttcctaaagttatca |
10469927 |
T |
 |
| Q |
214 |
tttgtttgaaggagtgaat |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10469926 |
tttgtttgaaggagtgaat |
10469908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University