View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11650_high_25 (Length: 231)
Name: NF11650_high_25
Description: NF11650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11650_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 30729898 - 30730098
Alignment:
| Q |
18 |
agaagtattattgcaaagggcttatttaatttaatttgattatttggtctctgactataaaacgttaaaaataattaaacaccagccccacatagccagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30729898 |
agaagtattattgcaaagggcttatttaatttaatttgattatttggtctctgactataaaacgttaaaaataatttaacaccagccccacatagccagt |
30729997 |
T |
|
| Q |
118 |
gattcaaatacattatcacctaatccttgttcttaagcaataatactaagtggcttgtacaagtgaacaacgaagaaaatatgtgtttagctacctttgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30729998 |
gattcaaatacattatcacctaatccttgttcttaagcaataatactaagtggcttgtacaagtgaacaacgaagaaaatatgtgtttagctacctttgc |
30730097 |
T |
|
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
30730098 |
t |
30730098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University