View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11650_low_22 (Length: 249)
Name: NF11650_low_22
Description: NF11650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11650_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 7737563 - 7737796
Alignment:
| Q |
5 |
gacagtatcacataatattacttcaaagataatagggattgcagcaaaacacaatctcagattattttgtttctcacctaatgatgatgaagcatgttga |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7737563 |
gacagtatcacataatattacttcaaagataatagggattgcagcaaaacacaatctcagattattttgtttctcacctaatgatgatgaagcatgtaga |
7737662 |
T |
|
| Q |
105 |
ttggttattggattcttctgacctccatttcttggaaacatcccatgtgccataggtgatatgctaggatttggtttcggagtcaaggatggaatctttg |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737663 |
ttggttattggatttttctgacctccatttcttggaaacatcccatgtgccataggtgatatgctaggatttggtttcggagtcaaggatggaatctttg |
7737762 |
T |
|
| Q |
205 |
taaaaatactttttgatgccacacgaccccttct |
238 |
Q |
| |
|
||| || ||||||||||||||||||||||||||| |
|
|
| T |
7737763 |
taagaagactttttgatgccacacgaccccttct |
7737796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 7737505 - 7737541
Alignment:
| Q |
35 |
aatagggattgcagcaaaacacaatctcagattattt |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
7737505 |
aatagggattgcagtaaaacacaatctcagaatattt |
7737541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University