View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11650_low_23 (Length: 249)
Name: NF11650_low_23
Description: NF11650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11650_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 100 - 245
Target Start/End: Original strand, 49017723 - 49017868
Alignment:
| Q |
100 |
gccacctagctagctacatgaatttgcatgaagaataaaaatgatgtgagtgcttttcatttcacgtacggggcctccctcattcaaggatattctcatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49017723 |
gccacctagctagctacatgaatttgcatgaagaataaaaatgatgtgagtgcttttcatttcacgtacggggcctccctcattcaaggatattctcatt |
49017822 |
T |
|
| Q |
200 |
atttacatgccacgcctgattcttttttgttttctttcttctctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49017823 |
atttacatgccacgcctgattcttttttgttttctttcttctctct |
49017868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 49017624 - 49017667
Alignment:
| Q |
1 |
aatcgtttttaattttgatgttgatatgggtgcatgcatgcttt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49017624 |
aatcgtttttaattttgatgttgatatgggtgcatgcatgcttt |
49017667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 148 - 219
Target Start/End: Complemental strand, 7083449 - 7083380
Alignment:
| Q |
148 |
agtgcttttcatttcacgtacggggcctccctcattcaaggatattctcattatttacatgccacgcctgat |
219 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
7083449 |
agtgcatttcatttcacgtacggga--tccacaattcaaggatattctaattatttacatgtcacgcctgat |
7083380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University