View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11650_low_27 (Length: 241)
Name: NF11650_low_27
Description: NF11650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11650_low_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 241
Target Start/End: Original strand, 7737205 - 7737424
Alignment:
| Q |
20 |
atattggttcaactcactaaaagtgtaattctcctacactgtcagtttcaaattcagtggatgaaaatttaatccagctcactaaatgtaaaaactcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7737205 |
atattggttcaactcactaaaagtgtaattctcctacactgtcagttt--aattccgtggatgaaaacttaatccagctcactaaatgtaaaaactcttc |
7737302 |
T |
|
| Q |
120 |
aaagcaatgaagtcatgctactaatcttcaaacctatttcggtagaactatatcataaactatcacaacagtgacaataacaaatttttcagcaaccaca |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7737303 |
aaagcaatgcagtcatgctactaatcttcaaacctatttcggtagaactatatcataaagtatcacaacagtgacaataacaaaattttcagcaaccaca |
7737402 |
T |
|
| Q |
220 |
atttaattccatcaaatcagct |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7737403 |
atttaattccatcaaatcagct |
7737424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University