View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11650_low_31 (Length: 209)
Name: NF11650_low_31
Description: NF11650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11650_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 13 - 140
Target Start/End: Complemental strand, 14905257 - 14905129
Alignment:
| Q |
13 |
gcatagggaagcccagttacgtaatactcactcaaatggtaggnnnnnnnn-ggtagaaaacctaatgagaaaagtttttcttttctttccattgttttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
14905257 |
gcatagggaagcccagttacgtaatactcactcaaatggtaggaaaaaaaatggtagaaaacctaatgaggaaaatttttcttttctttccattgttttt |
14905158 |
T |
|
| Q |
112 |
tctattaatgggttaggcttatccctcac |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14905157 |
tctattaatgggttaggcttatccctcac |
14905129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 67 - 140
Target Start/End: Complemental strand, 14888412 - 14888338
Alignment:
| Q |
67 |
agaaaacctaatgagaaaagttttt-cttttctttccattgttttttctattaatgggttaggcttatccctcac |
140 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14888412 |
agaaaacctaatgaggaattttttttcttttctttccattgttttttctattaatgggttaggcttatccctcac |
14888338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 193
Target Start/End: Complemental strand, 14905107 - 14905077
Alignment:
| Q |
163 |
atcttaagtaaatatttagcttaggaatact |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14905107 |
atcttaagtaaatatttagcttaggaatact |
14905077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University