View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_100 (Length: 208)
Name: NF11651_high_100
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 22097970 - 22098145
Alignment:
| Q |
18 |
taatccatctgtaacctttccctatagactcctaattttggtcacactttccttctttggtattctttgtctttttccagagtcctaattctttcaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22097970 |
taatccatctgtaacctttccctatagactcctaattttggtcacactttccttctttggtattctttgtctttttccagagtcctaattctttcaacaa |
22098069 |
T |
 |
| Q |
118 |
acgaaatgcttgtgttttatgtgtgacaggacaaaataaaacctctctctttgtctttctttttaatttccctttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22098070 |
acgaaatgcttgtgttttatgtgtgacaggacaaaataaaacctctctctttgtctttctttttaatgtccctttg |
22098145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University