View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_21 (Length: 517)
Name: NF11651_high_21
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 446; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 18 - 506
Target Start/End: Complemental strand, 23715617 - 23715128
Alignment:
| Q |
18 |
atatcgatgtagacattatcacatgacaaccaataataggccatgcctttccctttcatatgttattgctcattttgttgttacattcagaagcaaataa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715617 |
atatcgatgtagacattatcacatgacaaccaataataggccatgcctttccctttcatattttattgctcattttgttgttacattcagaagcaaataa |
23715518 |
T |
|
| Q |
118 |
taatacacaatacattttctttatggtcttttagaccttaactaatgagaaaaaagaattttctcaaatttaatggatgcagtatactttcattgacatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715517 |
taatacacaatacattttctttatggtcttttagaccttaactaatgagaaaaaagaattttctcaaatttaatggatgcagtatactttcattgacatt |
23715418 |
T |
|
| Q |
218 |
acaatttacaacatgtcatgatgatgcacactttgcttagttctcaatattgcatattgaactcttcc-nnnnnnnnactttcattttaccttgcttatc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23715417 |
acaatttacaacatgtcatgatgatgcacactttgcttagttctcaatattgcatattgaactcttcctttttttttactttcattttaccttgcttatc |
23715318 |
T |
|
| Q |
317 |
gagcatagttgcatatgcaattatcattcactcatcagcaaaaacacaacaataggtatcaacatcattgtggcttatcatcaacgtattcattttcgga |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715317 |
aagcatagttgcatatgcaattatcattcactcatcagcaaaaacacaacaataggtatcaacatcattgtggcttatcatcaacgtattcattttcgga |
23715218 |
T |
|
| Q |
417 |
agcaatcatcccggaactacggccgctcatttttccgaatgaatttacattggacaatcccttgaaactgctgctgctaccctcgttcat |
506 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23715217 |
agcaatcatcccggaactacggccgctcatttttccgaatgaattcacattggacaatcccttgaaactgctgctgctaccctcgttcat |
23715128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University