View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_33 (Length: 393)
Name: NF11651_high_33
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 52336126 - 52335750
Alignment:
| Q |
1 |
gttaagagagcaaaagaagaaatcctccaagtttctacttgctcctgtcgatgcctctcgtgaaagccttcgctctgtttatctttatctcagtacgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52336126 |
gttaagagagcaaaagaagaaatcctccaagtttctacttgctcctgtcgatgcctctcgtgaaagccttcgctctgtttatctttatctcagtacgaat |
52336027 |
T |
 |
| Q |
101 |
ttttcttttctcttctcttatatctacacattgttttatatcttatcagggtttgtttgtttcggttccttttcacagcggaaactggtgctacttatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52336026 |
ttttcttttctcttctcttatatctacacattgttttatatcttattagggtttgtttgtttcggttccttttcacagcggaaactggtgctacttatac |
52335927 |
T |
 |
| Q |
201 |
agatgaagatttgcagaaatttcagcagctattcagatctgctgccagggattgtgtcccagaggataggaattctttcgtcgctttccaagctaacacc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52335926 |
agatgaagatttgcagaaatttcagcagctattcagatctgctgccagggattgtgtcccagaggataggaattctttcgtcgctttccaagctaacacc |
52335827 |
T |
 |
| Q |
301 |
ggagttgaggtttgtctttgccaattgtcatcatctactaatgtcttgctaattagggtttggatggatgacataat |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52335826 |
ggagttgaggtttgtctttgccaattgtcatcatctactaatgtcttgctaattagggttttgatggatgacataat |
52335750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University