View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11651_high_34 (Length: 385)

Name: NF11651_high_34
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11651_high_34
NF11651_high_34
[»] chr7 (3 HSPs)
chr7 (118-379)||(3684292-3684554)
chr7 (18-117)||(3684117-3684216)
chr7 (118-282)||(3676119-3676292)
[»] chr6 (9 HSPs)
chr6 (234-274)||(9159140-9159180)
chr6 (234-274)||(9171248-9171288)
chr6 (234-274)||(7013266-7013306)
chr6 (234-274)||(7026202-7026242)
chr6 (42-84)||(212981-213023)
chr6 (234-275)||(7047252-7047293)
chr6 (234-266)||(7041918-7041950)
chr6 (139-191)||(9159225-9159277)
chr6 (139-191)||(9171151-9171203)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 118 - 379
Target Start/End: Original strand, 3684292 - 3684554
Alignment:
118 gcacatatcttcccatttcgctgacatgacagagaacaccttccaattctcatcaccatttttcaaaagtaacgacgaatctgaggtggacaacttgctg 217  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3684292 gcacatgtcttcccatttcgctgacatgacagagaacgccttccaattctcatcaccatttttcaaaagtaacgacgaatctgaggtggacaacttgctg 3684391  T
218 agaatgaggnnnnnnn-ccatggcacgtgacagcaacgacctttttagggtacatgtagccatagtcaaagtagccacgattgttgggttcattattctc 316  Q
    ||||||| |        ||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||    
3684392 agaatgaagttttttttccatggcacgtgatagcaacgacctttttagggtacatgtacccatagtcatagtagccacgattgttgggttcattattctc 3684491  T
317 ccgtggtgaagtccatggagttgagaccggtctgcttctgccatgaatgctgctctgtgctgc 379  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
3684492 ccgtggtgaagtccatggagttgagaccggtctgcttctgccatgaatgctgctgtgtgctgc 3684554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 3684117 - 3684216
Alignment:
18 gatataaacactcacaagcgtcctctaacaacaaatcaccctcgctctcccctaagaactttatgcccctgccatcatcaaccaaagctttggccactaa 117  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
3684117 gatataaacactcagaagcgtcctctaacaacaaatcaccctcgctctcccctaagaactttatgcccctgccaccatcaaccaaagctttggccactaa 3684216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 118 - 282
Target Start/End: Original strand, 3676119 - 3676292
Alignment:
118 gcacatatcttcccatttcgctgacatgacagagaacaccttccaattctcatca-------ccatttttcaaaagtaacgacgaatctgaggtggacaa 210  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |       ||| ||||||||||||| ||||||||||||||||||||    
3676119 gcacatatcttcccattttgctgacatgtcagagaacaccttccaattctcatgagtcatgaccacttttcaaaagtaatgacgaatctgaggtggacaa 3676218  T
211 cttgctgagaatgagg--nnnnnnnccatggcacgtgacagcaacgacctttttagggtacatgtagccatagt 282  Q
    ||||||||||||||||         |||||||| |||||| |||||||||||||||||||||||||||||||||    
3676219 cttgctgagaatgaggttgttttttccatggcatgtgacaacaacgacctttttagggtacatgtagccatagt 3676292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 234 - 274
Target Start/End: Complemental strand, 9159180 - 9159140
Alignment:
234 ccatggcacgtgacagcaacgacctttttagggtacatgta 274  Q
    |||||||||||||||||||||||||||||||||||||||||    
9159180 ccatggcacgtgacagcaacgacctttttagggtacatgta 9159140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 9171248 - 9171288
Alignment:
234 ccatggcacgtgacagcaacgacctttttagggtacatgta 274  Q
    |||||||||||||||||||||||||||||||||||||||||    
9171248 ccatggcacgtgacagcaacgacctttttagggtacatgta 9171288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 7013266 - 7013306
Alignment:
234 ccatggcacgtgacagcaacgacctttttagggtacatgta 274  Q
    ||||||||||| ||| |||||||||||||||||||||||||    
7013266 ccatggcacgtaacaacaacgacctttttagggtacatgta 7013306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 7026202 - 7026242
Alignment:
234 ccatggcacgtgacagcaacgacctttttagggtacatgta 274  Q
    ||||||||||| ||| |||||||||||||||||||||||||    
7026202 ccatggcacgtaacaacaacgacctttttagggtacatgta 7026242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 213023 - 212981
Alignment:
42 ctaacaacaaatcaccctcgctctcccctaagaactttatgcc 84  Q
    |||||||||||||||||||||||||| ||||||| || |||||    
213023 ctaacaacaaatcaccctcgctctccactaagaatttcatgcc 212981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 275
Target Start/End: Original strand, 7047252 - 7047293
Alignment:
234 ccatggcacgtgacagcaacgacctttttagggtacatgtag 275  Q
    ||||||||||||||||||| |||||||| |||| ||||||||    
7047252 ccatggcacgtgacagcaatgaccttttcagggaacatgtag 7047293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 234 - 266
Target Start/End: Original strand, 7041918 - 7041950
Alignment:
234 ccatggcacgtgacagcaacgacctttttaggg 266  Q
    ||||||||||||||||||||||||||| |||||    
7041918 ccatggcacgtgacagcaacgacctttataggg 7041950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 9159277 - 9159225
Alignment:
139 tgacatgacagagaacaccttccaattctcatcaccatttttcaaaagtaacg 191  Q
    ||||||| ||| || ||||||||||| ||||||||||  ||||||||||||||    
9159277 tgacatgtcagggatcaccttccaatcctcatcaccacatttcaaaagtaacg 9159225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 9171151 - 9171203
Alignment:
139 tgacatgacagagaacaccttccaattctcatcaccatttttcaaaagtaacg 191  Q
    ||||||| ||| || ||||||||||| ||||||||||  ||||||||||||||    
9171151 tgacatgtcagggatcaccttccaatcctcatcaccacatttcaaaagtaacg 9171203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University