View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_49 (Length: 320)
Name: NF11651_high_49
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 13 - 305
Target Start/End: Original strand, 4498620 - 4498912
Alignment:
| Q |
13 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttgga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4498620 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttgga |
4498719 |
T |
 |
| Q |
113 |
tttgcagcagggttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498720 |
tttgcagcagggttttggggggtttgcattgctactttcttgatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
4498819 |
T |
 |
| Q |
213 |
atgatacctttgtctttatctgtcaagagggacgaaaatgtgggaattggaccatcccgctgctaggagtctggtcgatattgaagttgtatt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4498820 |
atgatacctttgtctttatctgtcaagagggatgaaaatgtgggaattggaccataccgccgctaggagtctggtcgatattgaagttgtatt |
4498912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 4329289 - 4329074
Alignment:
| Q |
13 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttgga |
112 |
Q |
| |
|
|||||| |||||||| ||| | ||||||||||||||| |||||||||| ||||| |||||| | |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4329289 |
gatgaataattgtacaaaaatgaaacaagttttggagcgtggaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttgga |
4329190 |
T |
 |
| Q |
113 |
tttgcagcagggttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329189 |
tttgcagcagggttttggggggtttgcattgctattttctttaacagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
4329090 |
T |
 |
| Q |
213 |
atgatacctttgtctt |
228 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
4329089 |
atgagacctttgtctt |
4329074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 301
Target Start/End: Complemental strand, 4329036 - 4328963
Alignment:
| Q |
232 |
ctgtcaagagggacgaaaatgtgggaattggaccat----cccgctgctaggagtctggtcgatattgaagttg |
301 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
4329036 |
ctgtcaagagggatgaaaatgtggaaattggaccataccgcacgccactaggagtctggtcgatattgaagttg |
4328963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University