View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_50 (Length: 320)
Name: NF11651_high_50
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 44199210 - 44198921
Alignment:
| Q |
18 |
acattctgcagctacattgcgttgcagggctttacctcctccttgctttagtaacccctatttaaaggacctttcccaaaaggagacagatccctatgca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199210 |
acattctgcagctacattgcgttgcagggctatacctcctccttgctttagtaacccctatttaaaggacctttcccaaaaggagacagatccctatgca |
44199111 |
T |
|
| Q |
118 |
aaccaaagatccaaatgtgcaggtatcactctagtcaatcctttacaagtatcccgttcattaatggtggaaaagtcattgtaactggcctgatctttta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199110 |
aaccaaagatccaaatgtgcaggtatcactctagtcaatcctttacaagtatcccgttcattaatggtggaaaagtcattgtaactggcctgatctttta |
44199011 |
T |
|
| Q |
218 |
tctgttgttttctattcatttatattgccattttctaactgtataatggtatgactgtaggtttcttccctaaatttacagcttatgatg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199010 |
tctgttgttttctattcatttatattgccattttctaactgtataatggtatgattgtaggtttcttccctaaatttacagcttatgatg |
44198921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University