View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_52 (Length: 315)
Name: NF11651_high_52
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 19 - 120
Target Start/End: Original strand, 25747706 - 25747807
Alignment:
| Q |
19 |
ttgtttacccgccaactacatataaagtggcaacggtttgtgttttgaaccgttactatattttgcactcgtatcaatcaaatctattatgaatgaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
25747706 |
ttgtttacccgccaactacatataaagtggcaacggtttgtgttttgaaccgttactatattttgcactcgtataaatcaaatctattatgaataaattt |
25747805 |
T |
|
| Q |
119 |
gg |
120 |
Q |
| |
|
|| |
|
|
| T |
25747806 |
gg |
25747807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University