View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_63 (Length: 270)
Name: NF11651_high_63
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 115 - 204
Target Start/End: Original strand, 43557215 - 43557304
Alignment:
| Q |
115 |
gcttttcctttcaactcatgtgctaaagacacaaactttgatagttattggtggtatagcagtgacgaagacgatgaaacagacaccctt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43557215 |
gcttttcctttcaactcatgtgctaaagacacaaactttgatagttattggtggtatagcagtgacgaagacgatgaaacagacaccctt |
43557304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University