View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11651_high_70 (Length: 250)

Name: NF11651_high_70
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11651_high_70
NF11651_high_70
[»] chr1 (1 HSPs)
chr1 (1-108)||(10506400-10506506)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 10506506 - 10506400
Alignment:
1 tttctaaagtgggggaaccacaagggtttgatccaataagaagatatgtgttgaagagtgttagaaagagagtatatctaacacttctcttttgtgtaat 100  Q
    ||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
10506506 tttctaaagtgtgggaactacaagggtttgatccaataagaatatatgtgttgaagagtgttagaaagagagtatatgtaacacttct-ttttgtgtaat 10506408  T
101 gttgttta 108  Q
    ||||||||    
10506407 gttgttta 10506400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University