View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_70 (Length: 250)
Name: NF11651_high_70
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 10506506 - 10506400
Alignment:
| Q |
1 |
tttctaaagtgggggaaccacaagggtttgatccaataagaagatatgtgttgaagagtgttagaaagagagtatatctaacacttctcttttgtgtaat |
100 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
10506506 |
tttctaaagtgtgggaactacaagggtttgatccaataagaatatatgtgttgaagagtgttagaaagagagtatatgtaacacttct-ttttgtgtaat |
10506408 |
T |
 |
| Q |
101 |
gttgttta |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
10506407 |
gttgttta |
10506400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University