View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_high_93 (Length: 227)
Name: NF11651_high_93
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_high_93 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 46089472 - 46089277
Alignment:
| Q |
15 |
atgaacatggccacgacggtaaccaaagagggttccaacaacacgtgaaccaagaccagagggtagatttgaacggtttttgctgaatactgttaaaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46089472 |
atgaacatggccacgacggtaaccaaagagggttccaacaacacgtgaaccaagaccagagggtagatttgaacggtttttgctgaatactgttaaaaca |
46089373 |
T |
|
| Q |
115 |
gaacgtattcttgaaattgctacggtttgtagcttcttcctagttgctgcatgtcctcctgaaacaggtttttcttcatgttttttggtgttttgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46089372 |
gaacgtattcttgaaattgctacggtctgtagcttcttcctagttgctgcatgtcctcctgaaacaggtttttcttcatgttttttggtgttttgt |
46089277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 85 - 210
Target Start/End: Complemental strand, 46525189 - 46525064
Alignment:
| Q |
85 |
gaacggtttttgctgaatactgttaaaacagaacgtattcttgaaattgctacggtttgtagcttcttcctagttgctgcatgtcctcctgaaacaggtt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| || | ||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
46525189 |
gaacggtttttgctgaatactgttaaaatagtaagtattcttgaaattgcttcggtttgtagcttctttctagtagctgcatgtcctcctgaaacaggtt |
46525090 |
T |
|
| Q |
185 |
tttcttcatgttttttggtgttttgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46525089 |
tttcttcatgttttttggtgttttgt |
46525064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University