View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_39 (Length: 367)
Name: NF11651_low_39
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 21 - 295
Target Start/End: Complemental strand, 50756363 - 50756089
Alignment:
| Q |
21 |
tgagtcactatcaatatcctttatcaaactgctgaaaacctttgtatcagggacccccaaaccctctgccattagctctaatatctcacatgccacctct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50756363 |
tgagtcactatcaatatcctttatcaaactgctgaaaacctttgtatcagggacccccaaaccctctgccattagctctaatatctcacatgccacctct |
50756264 |
T |
|
| Q |
121 |
ttcactgcttctgtatattcactcaccctacacctgtcataatcataaatcttaaacatgattatttactgattattcattgatttcttagctgttgatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50756263 |
ttcactgcttctgtatattcactcaccctacacctgtcataatcataaatcttaaacatgattatttactgattattcattgttttcttagctgttgatg |
50756164 |
T |
|
| Q |
221 |
actactgaactcaagctttgtcagtgccactagtactctatctgcctctttccttgactactcactgcaccttcc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50756163 |
actactgaactcaagctttgtcagtgccactagtactctatctgcctctttccttgactactcactgcatcttcc |
50756089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 12610589 - 12610686
Alignment:
| Q |
63 |
tgtatcagggacccccaaaccctctgccattagctctaatatctcacatgccacctctttcactgcttctgtatattcactcaccctacacctgtcat |
160 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||| ||||| |||||||||||| |||| || ||| | ||||||| |
|
|
| T |
12610589 |
tgtatcagggacccccaaaccttctgccattagctccaatatctcacatgccagctccttcacagcttctgtatatgcacttacactagagctgtcat |
12610686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University