View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_40 (Length: 363)
Name: NF11651_low_40
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_40 |
 | |
|
| [»] scaffold0178 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0178 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 350
Target Start/End: Complemental strand, 18976 - 18637
Alignment:
| Q |
19 |
acaaccacacaaattggggtcacccattacaaccacatcaaagcttcaacaacataatccattatccattgtgatacatatctttttaacataaatggga |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
18976 |
acaaccacacaaattggg-tcacccattacaaccacatcaaagcttcaacaacataatccact-------gcgatacatatctttttaacataaatggga |
18885 |
T |
|
| Q |
119 |
gtaatgttgttagtcttgcaaactgataaaaatagagagtatgca----------------aaactgggtcacccattcccccacatcgaaaccactata |
202 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18884 |
gtagtgttgttagtcttgcaaactgataaaaatagagagtatgcataaagagttagttgcaaaactgggtcacccattcccccacatcgaaaccactaca |
18785 |
T |
|
| Q |
203 |
ataacagaaccattgaaatgattttttacaaccacacaaattgggtcatccatggaaattattttcnnnnnnnaccaaatatgacataatctttaaaaag |
302 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
18784 |
atagcagaaccattgaaatgattttttacaaccacacaaattgggtcatccatggaaattattttctttttttaccaaatatgacataatcgttaaaaag |
18685 |
T |
|
| Q |
303 |
ttcaaattgcagatttcttatttttgcaggtgatgatgagaagaagaa |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18684 |
ttcaaattgcagatttcttatttttgcaggtgatgatgagaagaagaa |
18637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University