View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11651_low_44 (Length: 355)

Name: NF11651_low_44
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11651_low_44
NF11651_low_44
[»] chr5 (7 HSPs)
chr5 (17-343)||(876970-877296)
chr5 (26-190)||(871871-872050)
chr5 (129-203)||(872515-872589)
chr5 (194-281)||(875495-875580)
chr5 (32-113)||(872404-872484)
chr5 (25-112)||(875340-875426)
chr5 (17-113)||(867994-868090)
[»] chr1 (2 HSPs)
chr1 (176-228)||(15776440-15776492)
chr1 (113-163)||(15776483-15776532)
[»] chr4 (1 HSPs)
chr4 (176-228)||(42040803-42040855)


Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 17 - 343
Target Start/End: Original strand, 876970 - 877296
Alignment:
17 aggtacagcaaattgattaacatcttcatacccatggaaaagagatagattcatatcaactgaaaacatggtcaatctttaatacaaggtgttgcaagtt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
876970 aggtacagcaaattgattaacatcttcatacccatggaaaagagatagattcatatcaactgaaaacatggtcaatctttaatacaaggtgttgcaagtt 877069  T
117 ttaatggttgagaactgacacagattgggaaatggttcggtttgttgaactgtttcgtctggtgtgtcgggtattgaattgaatgagacagtgatgatgg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
877070 ttaatggttgagaactgacacagattgggaaatggttcggtttgttgaactgtttcgtctggtgtgtcgggtattgaattgaatgagacagtgatgatgg 877169  T
217 atggatggttctggcgaggtgcttctatatcttgttgacgcagccagtgatctctctctttctgagtcatttgcaactacttattgtgaggctttgccgc 316  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
877170 atggatggttctggcgaggtgcttctatatcttgttgacgcagccagtgttctctctctttctgagtcatttgcaactacttattgtgaggctttgccgc 877269  T
317 tctcagagctgactatttctgtctctg 343  Q
    |||||||||||||||||||||||||||    
877270 tctcagagctgactatttctgtctctg 877296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 26 - 190
Target Start/End: Original strand, 871871 - 872050
Alignment:
26 aaattgattaacatcttcatacccatggaaaagagatagattcatatc-aactgaaaacatggtcaatctttaatacaaggtgttgca------------ 112  Q
    ||||||||||| ||||||||||| |||| ||| || |||||||||| | |||||||||||| |||||||||||||| ||| |||||||                
871871 aaattgattaaaatcttcataccgatggcaaaaaggtagattcataaccaactgaaaacattgtcaatctttaatataagatgttgcaaccttgttttgc 871970  T
113 ---agttttaatggttgagaactgacacagattgggaaatggttcggtttgttgaactgtttcgtctggtgtgtcgggtat 190  Q
       | |||| ||||||| |||| ||||||||||||| |||||||||||||||||||||||||| | |||| ||| ||||||    
871971 tataattttcatggttgcgaaccgacacagattggg-aatggttcggtttgttgaactgtttcttgtggtatgttgggtat 872050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 872515 - 872589
Alignment:
129 aactgacacagattgggaaatggttcggtttgttgaactgtttcgtctggtgtgtcgggtattgaattgaatgag 203  Q
    ||||||||||||||| ||||||||||||| |||||||||||||| ||| |||||| ||||||  | |||||||||    
872515 aactgacacagattgagaaatggttcggtatgttgaactgtttcttctcgtgtgttgggtatgtatttgaatgag 872589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 194 - 281
Target Start/End: Original strand, 875495 - 875580
Alignment:
194 attgaatgagacagtgatgatggatggatggttctggcgaggtgcttctatatcttgttgacgcagccagtgatctctctctttctga 281  Q
    |||||||||| ||||||||||| ||||||||||||||| ||| | |||  |||| |||||||||||||||  |||| |||||||||||    
875495 attgaatgaggcagtgatgatgtatggatggttctggcaaggcgtttc--tatcatgttgacgcagccagccatctttctctttctga 875580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 113
Target Start/End: Original strand, 872404 - 872484
Alignment:
32 attaacatcttcatacccatggaaaagagatagattcat-atcaactgaaaacatggtcaatctttaatacaaggtgttgcaa 113  Q
    |||||||||||||||||||||| ||||| |||||||||| ||||||||  ||| | |||||||||||||| ||| ||||||||    
872404 attaacatcttcatacccatggcaaagaaatagattcataatcaactg--aacgttgtcaatctttaatataagatgttgcaa 872484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 25 - 112
Target Start/End: Original strand, 875340 - 875426
Alignment:
25 caaattgattaacatcttcatacccatggaaaagagatagattcatatcaactgaaaacatggtcaatctttaatacaaggtgttgca 112  Q
    |||||||||||||||||||||||||||| | || ||||||||||| |  ||||||||   | |||| |||||||||||| ||||||||    
875340 caaattgattaacatcttcatacccatgaataaaagatagattca-acaaactgaaatttttgtcattctttaatacaaagtgttgca 875426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 17 - 113
Target Start/End: Original strand, 867994 - 868090
Alignment:
17 aggtacagcaaattgattaacatcttcatacccatggaaaagagatagattcata-tcaactgaaaacatggtcaatctttaatacaaggtgttgcaa 113  Q
    ||||||| || |||||||| ||||||||||||| ||| ||| || || ||||||| |||||| ||||| | || ||||||| ||||||||||||||||    
867994 aggtacaacacattgatta-catcttcatacccttggcaaaaagttaaattcataatcaactcaaaactttgttaatctttgatacaaggtgttgcaa 868090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 176 - 228
Target Start/End: Complemental strand, 15776492 - 15776440
Alignment:
176 tggtgtgtcgggtattgaattgaatgagacagtgatgatggatggatggttct 228  Q
    |||| ||| ||||||||||||||||||||||||||||||| ||||||||||||    
15776492 tggtttgttgggtattgaattgaatgagacagtgatgatgtatggatggttct 15776440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 113 - 163
Target Start/End: Complemental strand, 15776532 - 15776483
Alignment:
113 agttttaatggttgagaactgacacagattgggaaatggttcggtttgttg 163  Q
    |||||||||||||||||| |||||| ||||||| ||||||| |||||||||    
15776532 agttttaatggttgagaagtgacacggattggg-aatggtttggtttgttg 15776483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 42040803 - 42040855
Alignment:
176 tggtgtgtcgggtattgaattgaatgagacagtgatgatggatggatggttct 228  Q
    |||| ||| |||||||||||||||||||||||| |||||| ||||||||||||    
42040803 tggtttgttgggtattgaattgaatgagacagtcatgatgtatggatggttct 42040855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University