View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_55 (Length: 313)
Name: NF11651_low_55
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 10189473 - 10189518
Alignment:
| Q |
244 |
tttatgatatatcaaatctctattgttaatctcaaggtttttaata |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10189473 |
tttatgatatatcaaatctctattgttaatctcaaggtttttaata |
10189518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 95 - 186
Target Start/End: Original strand, 10185579 - 10185670
Alignment:
| Q |
95 |
atttaacattgttaacttatgaaaataattgactacataannnnnnnatcttatttggtcctcaaatggtgagactctagctttgccattgt |
186 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| || |||||| ||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
10185579 |
atttaacattgttaatttatgaaaataatcgactacaaaaaatatttatcttaattggtcctccaatgctgagactctagccttgccattgt |
10185670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University