View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_57 (Length: 298)
Name: NF11651_low_57
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 12243612 - 12243327
Alignment:
| Q |
1 |
tcactggtgctactttgatgctcacttcacgtcaaaaaggatattatagggattcttatgtccatgtggagtttaatgacatgccagcttattggtaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12243612 |
tcactggtgctactttgatgctcacttcacgtcaaaaaggatattatagggattcttatgtccatgtggagtttaatgacatgccagcttattggcaagt |
12243513 |
T |
 |
| Q |
101 |
gcaataacaaatttatatttaaatacattttaggttataaagatatgacacttttcaaaataaacatgatccggtgttggacatgcatcatgtctgatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||| || |||||||||| || |||||||||| |||||| ||||||| |
|
|
| T |
12243512 |
gcaataacaaatttatatttaaatacattttagattataaagatccgacacttttcgaattaaacatgattcgatgttggacatatatcatgcctgatac |
12243413 |
T |
 |
| Q |
201 |
gacacatataattaaattgaactatgtga---nnnnnnnncttcaaattatta-tagtgcggcgtgtgtgtcttatctgtatttgt |
282 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12243412 |
gacacatataattaaattgaattatgtgatttttttttttctttaaattattagtagtgcggcgtgtgtgtcttatctgtatttgt |
12243327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University