View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_58 (Length: 290)
Name: NF11651_low_58
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 14457683 - 14457792
Alignment:
| Q |
1 |
cttgcagggtcagtatggatggatttgaattggatatgagtttagaatttatctctcttatatcttacagctgagtagtagaattttacagtgcagttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14457683 |
cttgcagggtcagtatggatggatttgaattggatatgagtttagaatttatctctcttatatcttacagctgagtagtagaattttacagtgcagttaa |
14457782 |
T |
 |
| Q |
101 |
actacaacat |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
14457783 |
actacaacat |
14457792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 151 - 273
Target Start/End: Original strand, 14457799 - 14457921
Alignment:
| Q |
151 |
ataataaaaagaaaatcaaactacaacattggcttttcatcagtttgttgtgtgcatggtgaatcttacattcacctcctcttcttgctcgtctcctctt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
14457799 |
ataataaaaagaaaatcaaactacaacattggctttccatcagcttgttgtgtgcatggtgaatcttacattcgcctcctcttcttgctcgtatcctctt |
14457898 |
T |
 |
| Q |
251 |
catacttatcgacaacagcttcc |
273 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14457899 |
catacttatcgacaacagcttcc |
14457921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 115 - 273
Target Start/End: Original strand, 14466638 - 14466794
Alignment:
| Q |
115 |
ataaatatacaatcctaaaaaacatttgtaatcatgataataaaaagaaaatcaaactacaacattggcttttcatcagtttgttgtgtgcatggtgaat |
214 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||||||| ||||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
14466638 |
ataaatacacaatccttaaaaacatctgtaatcatgatgataaaaagaaaatcaaactgcaacattggc-tttcatcagcttgttgtgtgcacggtgaat |
14466736 |
T |
 |
| Q |
215 |
cttacattcacctcctcttcttgctcgtctcctcttcatacttatcgacaacagcttcc |
273 |
Q |
| |
|
|||||| || ||||||||| ||||| || |||||||| ||||| ||||||||||||||| |
|
|
| T |
14466737 |
cttaca-tcgcctcctcttgttgcttgtttcctcttcgtacttgtcgacaacagcttcc |
14466794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University