View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_64 (Length: 271)
Name: NF11651_low_64
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 114 - 253
Target Start/End: Original strand, 4387972 - 4388111
Alignment:
| Q |
114 |
tgcttctgtaaagaacttgttcctcggcttactatgttttgctttctccatgattcaacaaattgtttgattggagtcacaaaggaaggcagagcgacac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387972 |
tgcttctgtaaagaacttgttcctcggcttactatgttttgctttctccatgattaaacaaattgtttgattggagtcacaaaggaaggcagagcgacac |
4388071 |
T |
|
| Q |
214 |
aaatcaacacaatcattgatgagatgataggatcaacaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388072 |
aaatcaacacaatcattgatgagatgataggatcaacaaa |
4388111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University