View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11651_low_65 (Length: 270)

Name: NF11651_low_65
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11651_low_65
NF11651_low_65
[»] chr8 (1 HSPs)
chr8 (115-204)||(43557215-43557304)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 115 - 204
Target Start/End: Original strand, 43557215 - 43557304
Alignment:
115 gcttttcctttcaactcatgtgctaaagacacaaactttgatagttattggtggtatagcagtgacgaagacgatgaaacagacaccctt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43557215 gcttttcctttcaactcatgtgctaaagacacaaactttgatagttattggtggtatagcagtgacgaagacgatgaaacagacaccctt 43557304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University