View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_66 (Length: 269)
Name: NF11651_low_66
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 18938120 - 18938356
Alignment:
| Q |
17 |
acatcacacggggagtataatttaaagacaacgtatcactacatcatggaaattttattggataatagtgatttatgagttcccgataactggatgaaaa |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
18938120 |
acatcacacggggagtataatgtaaagacaacgtatcactacatcatggaaatttta-tggataatagtgatttacgagttcctgataactggatgaaaa |
18938218 |
T |
|
| Q |
117 |
tatggaacatcaaaatccctcnnnnnnntaaaagttttcttgtggcgtg-ggcaaggggctgccttcctacaagggaaatacttcgcactatatgagtta |
215 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
18938219 |
tatggaacattaaaatccctcaaaaaaataaaagttttcttgtggcgtgcggcaaggggctgccttcctacaagggaaatacttcgcactatttg----a |
18938314 |
T |
|
| Q |
216 |
gtttaatgtacggatatgtgttcattgtgagggatctgatga |
257 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
18938315 |
gtttaatgtacggatatgtgttagttgtgagggatcttatga |
18938356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University