View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_73 (Length: 250)
Name: NF11651_low_73
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 40 - 192
Target Start/End: Complemental strand, 6486830 - 6486678
Alignment:
| Q |
40 |
acaacaataataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcag |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486830 |
acaacaacaataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcag |
6486731 |
T |
 |
| Q |
140 |
cagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486730 |
cagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
6486678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 250
Target Start/End: Complemental strand, 6486653 - 6486619
Alignment:
| Q |
216 |
acataagttagcgattatgtcaattttctttattt |
250 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6486653 |
acataagttagtgattatgtcaattttctttattt |
6486619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University