View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_82 (Length: 240)
Name: NF11651_low_82
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6036910 - 6037131
Alignment:
| Q |
1 |
tatcgtaatgaattcgacgttaaactttgaagtttaaatagttattgttcttttgtggtctttcctcaggtgattgtctcggtggttagaagccgagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6036910 |
tatcgtaatgaattcgacgttaaactttgaagtttaaatagttattgttcttttgtggtctttcctcaggtgattgtctcggtggttagaagtcgagcta |
6037009 |
T |
 |
| Q |
101 |
tggagaaacaaaagaacaagccaagcctactgagagagagtttttcctgggtatattctcctgcaacaagagaattatgtgttaccgggaaaatggaacc |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6037010 |
tggagaaacaaaagaacaagccaggcctactgagagagagtttttcctgggtatattctcctacaacaagagaattatgtgttactgggaaaatggaacc |
6037109 |
T |
 |
| Q |
201 |
aaaggcaaaggagggaggtaat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6037110 |
aaaggcaaaggagggaggtaat |
6037131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University