View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_85 (Length: 239)
Name: NF11651_low_85
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 49803506 - 49803728
Alignment:
| Q |
1 |
aaagaatgatgaatttcacctcagcgacatagatggatgataaacaccgcctcaattattcatgataatttgcacgtgaagaaggaaaatgaggaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49803506 |
aaagaatgatgaatttcacctcagcgacatagatggatgataaacaccgcctcaattattcatgataatttgcacgtgaagaaggaaaatgaggaatgaa |
49803605 |
T |
 |
| Q |
101 |
aagtagtataccatcaaaggagagagaattgacgggaggattgatgatggtgatgatggcaactccatcagctccaacattcataaccgtgtgccctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49803606 |
aagtagtataccatcaaaggagagagaattgacgggaggattgatgatggtgatgatggcaactccatcagctccaacattcataaccgtgtgccctttt |
49803705 |
T |
 |
| Q |
201 |
ctgctactcatttttgatctaag |
223 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
49803706 |
ctgctactcattttttatctaag |
49803728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 109 - 199
Target Start/End: Complemental strand, 14110100 - 14110010
Alignment:
| Q |
109 |
taccatcaaaggagagagaattgacgggaggattgatgatggtgatgatggcaactccatcagctccaacattcataaccgtgtgcccttt |
199 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||| | || ||| ||||| ||||| |
|
|
| T |
14110100 |
taccatcaaaagagagagaattgacaggaggattgacgatggtgatgatggcaacaccatcagctccaacttccaaaacagtgtgtccttt |
14110010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University