View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_92 (Length: 229)
Name: NF11651_low_92
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 66 - 228
Target Start/End: Original strand, 47904668 - 47904830
Alignment:
| Q |
66 |
tcttcttataatcgattgcattaactctttgagctaaattagggagaagggtaaatggccattattctgtttggaatcttatcgttttctggtagaatcc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47904668 |
tcttcttataatcgattgcattaactctttgagctaaattagggagaagtgtaaatggccatcattctgtttggaatcttatcgttttctggtagaatcc |
47904767 |
T |
|
| Q |
166 |
gttttggatctggattgtggggtgaataggataaatatccttgtcattctcttctatcttctc |
228 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47904768 |
gttttggatccggattgtagggtgaataggataaatatccttgtcattctcttctatcttctc |
47904830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 47904610 - 47904644
Alignment:
| Q |
8 |
taatcatatgcaaaaagaaaagaaaataatccttc |
42 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47904610 |
taatcatttgcaaaaagaaaagaaaataatccttc |
47904644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University