View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_94 (Length: 228)
Name: NF11651_low_94
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 55200475 - 55200688
Alignment:
| Q |
1 |
gaaataggagggaaatgatggagtcaggatttgcggtgtggtgagaaacgaagagccacgtgccacctttagcttttttctttgtttggggagatggaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55200475 |
gaaataggagggaaatgatggagtcaggatttgcggtgtggtgagaaacgaagagccacgtaccacctttagcttttttctttgtttggggagatggaat |
55200574 |
T |
 |
| Q |
101 |
tggagagaggggttgagagaggatggaaattctaccggagcaggaacttgtggtgaagtaattagggttttggttgagagtgttgatgagagggattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55200575 |
tggagagaggggttgagagaggatggaaattctaccggagcaggaacttgtggtgaagtaattagggttttggttgagagtgttgatgagagggattatt |
55200674 |
T |
 |
| Q |
201 |
ggtgtatctgatga |
214 |
Q |
| |
|
||||| ||| |||| |
|
|
| T |
55200675 |
ggtgtgtctaatga |
55200688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University