View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_96 (Length: 222)
Name: NF11651_low_96
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_96 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 1293568 - 1293758
Alignment:
| Q |
20 |
aagaggaacggaaccgtgtaccttcgtcagagttggaagacgatctggattcgattccagcggagacgtattgtttgtggacaccgaattcatctccgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1293568 |
aagaggaacggaaccgtgtaccttcgtcagagttggaagacgatctggattcgattccagcggagacgtattgtttgtggacaccgaattcatctccgat |
1293667 |
T |
|
| Q |
120 |
ggcttctccgaaatcgccgattacttctccggtggcctcaccaatgaattctctctgcaagtgcaagaaaagcaattcaactggttcatct |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1293668 |
gaattctccgaaatcgccgattacttctccggtggcctcaccaatgaattctctctgcaagtgcaagaaaagcaattcaactggttcatct |
1293758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 101
Target Start/End: Original strand, 1304160 - 1304220
Alignment:
| Q |
41 |
cttcgtcagagttggaagacgatctggattcgattccagcggagacgtattgtttgtggac |
101 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
1304160 |
cttcgtcggaggtggaagacgatctggattcgattccggcggagtcgtattgtttctggac |
1304220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University