View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11651_low_97 (Length: 222)
Name: NF11651_low_97
Description: NF11651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11651_low_97 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 35302582 - 35302375
Alignment:
| Q |
15 |
cttttaacagaaccgccgtctctggtcaccgatgtggaaatggaagtccaaaaccagttttgaacattgaagctgaagaaaaagctataaaagaaaagaa |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302582 |
cttttaacagaaccaccgtctctggtcaccgatgtggaaatggaagtcctaaaccagttttgaacattgaagctgaagaaaaagctataaaagaaaagaa |
35302483 |
T |
 |
| Q |
115 |
gtttttcttacacccttcaccttcaactactccaagagactctgaacaacctcgtttgcttcctctgtttccaactacttctccaagagctcgtttgggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302482 |
gtttttcttacacccttcaccttcaactactccaagagactctgaacaacctcgtttgcttcctctgtttccaactacttctccaagagctcgtttgggt |
35302383 |
T |
 |
| Q |
215 |
ccttcttc |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
35302382 |
ccttcttc |
35302375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University