View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11652_high_12 (Length: 249)
Name: NF11652_high_12
Description: NF11652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11652_high_12 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 26294 - 26537
Alignment:
| Q |
1 |
aaaaataaatagtctccaaaatcttatattacttttgttttttcctccactcaagtctcattaagtatttgactacacagaatctcacatcacatgtttt |
100 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26294 |
aaaaaaaattagtctccaaatctttatattacttttgttttttcctccactcaagtctcatttagtatttgactacacagaatctcacatcacatgtttt |
26393 |
T |
 |
| Q |
101 |
tcccttattaagagcaagggcacatggctgcttcattggtttattattttacacattttgtcacacacatggaccacttggcatatgcaatttaaggcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||| |
|
|
| T |
26394 |
tcccttattaagagcaagggcacatggctgcttcattggtttattattttacacattttgtcagagagatggaccacttggcatatgcaatttaaggcaa |
26493 |
T |
 |
| Q |
201 |
ttctgccaaacattttgtctgaattaatcactgtctctgcttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
26494 |
ttctgccaaacattttgtctgaattaatcactgtcactgattct |
26537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University